A rust FFI library for minimap2. In development! Feedback appreciated!

Structure

minimap2-sys is the library of the raw FFI bindings to minimap2. minimap2 is the more rusty version.

How to use

Requirements

minimap2 = "0.1.20+minimap2.2.28"

Also see Features

Tested with rustc 1.64.0 and nightly. So probably a good idea to upgrade before running. But let me know if you run into pain points with older versions and will try to fix!

Minimap2 Version Table

Usage

Create an Aligner

let mut aligner = Aligner::builder()
    .map_ont()
    .with_threads(8)
    .with_cigar()
    .with_index("ReferenceFile.fasta", None)
    .expect("Unable to build index");

Align a sequence:

let seq: Vec<u8> = b"ACTGACTCACATCGACTACGACTACTAGACACTAGACTATCGACTACTGACATCGA";
let alignment = aligner
    .map(&seq, false, false, None, None)
    .expect("Unable to align");

Presets

All minimap2 presets should be available (see functions section):

let aligner = map_ont();
let aligner = asm20();

Customization

MapOpts and IdxOpts can be customized with Rust's struct pattern, as well as applying mapping settings. Inspired by bevy.

Aligner {
    mapopt: MapOpt {
        seed: 42,
        best_n: 1,
        ..Default::default()
    },
    idxopt: IdxOpt {
        k: 21,
        ..Default::default()
    },
    ..map_ont()
}

Working Example

There is a binary called "fakeminimap2" that I am using to test for memory leaks. You can follow the source code for an example. It also shows some helper functions for identifying compression types and FASTA vs FASTQ files. I used my own parsers as they are well fuzzed, but open to removing them or putting them behind a feature wall.

Alignment functions return a Mapping struct. The Alignment struct is only returned when the Aligner is created using .with_cigar().

A very simple example would be:

let mut file = std::fs::File::open(query_file);
let mut reader = BufReader::new(reader);
let mut fasta = Fasta::from_buffer(&mut reader)

for seq in reader {
    let seq = seq.unwrap();
    let alignment: Vec<Mapping> = aligner
        .map(&seq.sequence.unwrap(), false, false, None, None)
        .expect("Unable to align");
    println!("{:?}", alignment);
}

There is a map_file function that works on an entire file, but it is not-lazy and thus not suitable for large files. It may be removed in the future or moved to a separate lib.

let mappings: Result<Vec<Mapping>> = aligner.map_file("query.fa", false, false);

Multithreading

Multithreading is supported, for implementation example see fakeminimap2. Minimap2 also supports threading itself, and will use a minimum of 3 cores for building the index. Multithreading for mapping is left to the end-user.

let mut aligner = Aligner::builder()
    .map_ont()
    .with_index_threads(8);

Experimental Rayon support

This appears to work.

use rayon::prelude::*;

let results = sequences.par_iter().map(|seq| {
    aligner.map(seq.as_bytes(), false, false, None, None).unwrap()
}).collect::<Vec<_>>();

Features

The following crate features are available:

• mm2-fast - Replace minimap2 with mm2-fast. This is likely not portable.
• htslib - Support output of bam/sam files using htslib.
• simde - Compile minimap2 / mm2-fast with simd-everywhere support.
• map-file - Default - Convenience function for mapping an entire file. Caution, this is single-threaded.
• sse2only - Compiles for SSE2 support only (Default is to try to compile for SSE4.1, SSE2 only is default on aarch64)

Map-file is a default feature and enabled unless otherwise specified.

Missing Features

• setting mismatch penalty for base transitions minimap 2.27 release notes
• Generate ds tags to indicate uncertainty in indels

Potentially more, but I'm using this to keep track. I'd expect those would get implemented over time, but if you have urgent need open a pull request or an issue! Thanks

Building for MUSL

Follow these instructions.

In brief, using bash shell:

docker pull messense/rust-musl-cross:x86_64-musl
alias rust-musl-builder='docker run --rm -it -v "$(pwd)":/home/rust/src messense/rust-musl-cross:x86_64-musl'
rust-musl-builder cargo build --release

Please note minimap2 is only tested for x86_64. Other platforms may work, please open an issue if minimap2 compiles but minimap2-rs does not.

Features tested with MUSL

• mm2-fast - Fail
• htslib - Success
• simde - Success

Tools using this binding

• Chopper - Long read trimming and filtering
• mappy-rs - Drop-in multi-threaded replacement for python's mappy
• HiFiHLA - HLA star-calling tool for PacBio HiFi data
• STRdust - Tandem repeat genotyper for long reads

Want feedback

• Many fields are i32 / i8 to mimic the C environment, but would it make more sense to convert to u32 / u8 / usize?
• Let me know pain points!

Next things todo

• Print other tags so we can have an entire PAF format
• -sys Compile with SSE2 / SSE4.1 (auto-detect, but also make with features)
• Multi-thread guide (tokio async threads or use crossbeam queue and traditional threads?)
• Iterator interface for map_file
• MORE TESTS
• -sys Get SSE working with "sse" feature (compiles and tests work in -sys crate, but not main crate)
• -sys Possible to decouple from pthread?
• -sys Enable Lisa-hash for mm2-fast? But must handle build arguments from the command-line.

Citation

You should cite the minimap2 papers if you use this in your work.

Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]

and/or:

Li, H. (2021). New strategies to improve minimap2 alignment accuracy. Bioinformatics, 37:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]

Changelog

0.1.20 minimap2 2.28

• Fix htslib errors. No update to -sys crate needed.

0.1.19 minimap2 2.28

• Fix memory leak by @charlesgregory

0.1.18 minimap2 2.28

• Update to minimap2 v2.28 @jguhlin
• Support for lrhqae preset @jguhlin

0.1.17 minimap2 2.27

• Mark bam::Record objects as supplementary. #52 @PB-DB
• Only use rust-htslib/curl when curl feature is enabled. #53 @PB-DB
• Update to minimap2 v2.27 @jguhlin
• Switch to needletail for reading fast files (features map-file) @jguhlin
• Convert functions to take slices of vectors instead of refs to vecs &[Vec<u8>] instead of &Vec<Vec<u8>> @jguhlin
• breaking Curl is no longer a default option for htslib, please re-enable it as needed with cargo.toml features
• breaking Now using needletail for map-files, enabled by default. However, compression algorithms are disabled. Please enable with cargo.toml features
• Experimental rayon support
• aligner.with_cigar_clipping() to add soft clipping to the CIGAR vec (with_cigar() still adds to only the string, following the minimap2 outputs for PAF)
• breaking .with_threads() is now .with_index_threads() to make it more clear

0.1.16 minimap2 2.26

• Much better cross compilation support thanks to @Adoni5

0.1.15 minimap2 2.26

• Compilation on aarch64 thanks to @leiste375
• README corrections thanks to @wdecoster
• Better support for static builds / linking
• Update fffx to a version that uses bytelines without tokio. Drastically reduces compile times and dependency tree.

0.1.14 minimap2 2.26

• Memory leak fixed by @Adoni5
• Updated deps

0.1.13 minimap2 2.26

• Add with_seq to support indexing a single sequence (as per mappy: https://github.com/lh3/minimap2/blob/master/python/mappy.pyx#L115)
• minimap2-rs: update rust-htslib deps
• simdutf8 now optional dependency requiring map-file feature to be enabled
• Support soft-clipping string in CIGAR. WARNING: Does not support hard clipping. Please open an issue if you need this.
• Update minimap to 2.26
• Not convinced SSE41/SSE2 are working properly. Recommend simde.

0.1.11

• HTS lib: add support for optional quality scores by @eharr

0.1.10

• HTS lib support by @eharr
• HTS lib: Output sam/bam files by @eharr
• More tests by @eharr
• Display impl for Strand thanks to @ahcm
• Update minimap2-sys to latest version by @jguhlin
• -sys crate mm2fast added as additional backend by @jguhlin
• zlib dep changes by @jguhlin (hopefully now it is more portable and robust)
• -sys crate now supports SIMDe

0.1.9

• Thanks for @Adoni5 for switching to builder pattern, and @eharr for adding additional fields to alignment.
• Do not require libclang for normal compilation.

0.1.8

• Multithreading support (use less raw pointers, and treat more like rust Struct's)

0.1.7

• use libc instead of std:ffi::c_int as well

0.1.6

• Support slightly older versions of rustc by using libc:: rather than std::ffi for c_char (Thanks dwpeng!)
• Use fffx module for fasta/q parsing

Funding