2 unstable releases
| 0.2.0 | Jul 19, 2024 |
|---|---|
| 0.1.0 | Dec 13, 2023 |
#522 in Biology
86 downloads per month
Used in 2 crates
8KB
230 lines
What is SigAlign?
SigAlign is a library for biological sequence alignment, the process of matching two sequences to identify similarity, which is a crucial step in analyzing sequence data in bioinformatics and computational biology. If you are new to sequence alignment, a quick overview on Wikipedia will be helpful.
SigAlign is a non-heuristic algorithm that outputs alignments satisfying two cutoffs:
- Minimum Length
- Maximum Penalty per Length
In SigAlign, the penalty is calculated based on a gap-affine scheme, which imposes different penalties on mismatches, gap openings, and gap extensions.
Core Purpose
SigAlign is designed to be:
- ⚡️ Fast to collect highly similar alignments
- 💡 Easy to customize and explain results
- 🧱 Small and flexible to be a basic building block for other tools
SigAlign is not intended to:
- Align ultra-long reads
- Search for low similarity alignments
Quick Start Examples
For Rust developer
- As a Rust library, SigAlign can take advantage of the most abundant features in Rust.
- Registered on
crates.io: https://crates.io/crates/sigalign/ - API documentation: https://docs.rs/sigalign/
- Registered on
use sigalign::{
Aligner,
algorithms::Local,
ReferenceBuilder,
};
// (1) Build `Reference`
let fasta =
br#">target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC"#;
let reference = ReferenceBuilder::new()
.set_uppercase(true) // Ignore case
.ignore_base(b'N') // 'N' is never matched
.add_fasta(&fasta[..]).unwrap() // Add sequences from FASTA
.add_target(
"target_3",
b"AAAAAAAAAAA",
) // Add sequence manually
.build().unwrap();
// (2) Initialize `Aligner`
let algorithm = Local::new(
4, // Mismatch penalty
6, // Gap-open penalty
2, // Gap-extend penalty
50, // Minimum length
0.2, // Maximum penalty per length
).unwrap();
let mut aligner = Aligner::new(algorithm);
// (3) Align query to reference
let query = b"CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
let result = aligner.align(query, &reference);
println!("{:#?}", result);
For Python developer
- SigAlign's Python binding is available on PyPI: https://pypi.org/project/sigalign/
- Use
pipto install the package:pip install sigalign
- Use
from sigalign import Reference, Aligner
# (1) Construct `Reference`
reference = Reference.from_fasta_file("./YOUR_REFERENCE.fa")
# (2) Initialize `Aligner`
aligner = Aligner(4, 6, 2, 50, 0.2)
# (3) Execute Alignment
query = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA"
results = aligner.align_query(reference, query)
# (4) Display Results
for target_result in results:
print(f"# Target index: {target_result.index}")
for idx, alignment in enumerate(target_result.alignments):
print(f" - Result: {idx+1}")
print(f" - Penalty: {alignment.penalty}")
print(f" - Length: {alignment.length}")
print(f" - Query position: {alignment.query_position}")
print(f" - Target position: {alignment.target_position}")
For Web developer
- SigAlign offers a WebAssembly (WASM) build, opening up the potential for web-based applications. While it is not currently available through package managers such as
npm, plans for web support are in the pipeline. - An exemplary WASM implementation can be found within the
exampledirectory. Below is a TypeScript example showcasing SigAlign's application via this WASM wrapper:
import init, { Reference, Aligner, type AlignmentResult } from '../wasm/sigalign_demo_wasm';
async function run() {
await init();
// (1) Construct `Reference`
const fasta: string = `>target_1
ACACAGATCGCAAACTCACAATTGTATTTCTTTGCCACCTGGGCATATACTTTTTGCGCCCCCTCATTTA
>target_2
TCTGGGGCCATTGTATTTCTTTGCCAGCTGGGGCATATACTTTTTCCGCCCCCTCATTTACGCTCATCAC`;
const reference: Reference = await Reference.build(fasta);
// (2) Initialize `Aligner`
const aligner: Aligner = new Aligner(
4, // Mismatch penalty
6, // Gap-open penalty
2, // Gap-extend penalty
50, // Minimum aligned length
0.2, // Maximum penalty per length
);
// (3) Execute Alignment
const query: string = "CAAACTCACAATTGTATTTCTTTGCCAGCTGGGCATATACTTTTTCCGCCCCCTCATTTAACTTCTTGGA";
const result: AlignmentResult = await aligner.alignment(query, reference);
// (4) Parse and Display Results
const parsedJsonObj = JSON.parse(result.to_json());
console.log(parsedJsonObj);
}
run();
- To gain further insight into web-based implementation of SigAlign, visit the SigAlign tour page. This page utilizes the WASM wrapper exemplified above.
License
SigAlign is released under the MIT License.
Citation
Bahk, K., & Sung, J. (2024). SigAlign: an alignment algorithm guided by explicit similarity criteria. Nucleic Acids Research, 52(15), 8717-8733.
Dependencies
~1–1.9MB
~36K SLoC