#k-mer #dna #indexing #structure #transform #set

sbwt

Indexing sets of DNA k-mers with the spectral Burrow-Wheeler transform

8 releases

0.3.3 Oct 8, 2024
0.3.2 Sep 19, 2024
0.3.1 Aug 21, 2024
0.2.1 Jun 5, 2024
0.1.1 Mar 12, 2024

#987 in Data structures

Download history 3/week @ 2024-06-30 279/week @ 2024-08-18 14/week @ 2024-08-25 1/week @ 2024-09-01 289/week @ 2024-09-15 108/week @ 2024-09-22 75/week @ 2024-09-29 156/week @ 2024-10-06 19/week @ 2024-10-13

440 downloads per month

MIT license

235KB
3K SLoC

API documentation available at https://docs.rs/sbwt/latest/sbwt/.


lib.rs:

Introduction

This crate contains an implementation of the Bit Matrix SBWT data structure, as described in Small Searchable k-Spectra via Subset Rank Queries on the Spectral Burrows-Wheeler Transform, for the DNA alphabet ACGT. A CLI for the main features of the library can be found at https://github.com/jnalanko/sbwt-rs-cli. The data structure uses a variant of the Burrows-Wheeler transform to compress a set of k-mers in way that allows fast lookup queries. If the input k-mers are consecutive k-mers from longer underlying sequences, the index takes typically around 5 bits per distinct k-mer, supporting k-mer lookup queries at a speed of around 1 μs / k-mer on modern hardware.

Queries can be further sped up by using the Longest common suffix array, (see here) taking roughly log(k) bits of space per k-mer. The LCS array also enables the computation of k-bounded matching statistics and shortest frequency-bounded suffixes (both described here) Finally, the crate provides an interface for traversing the node-centric de Bruijn graph of the k-mers.

API Quick start

use sbwt::*;
use std::io::BufReader;
use std::io::BufWriter;
use std::fs::File;
use std::path::Path;

// Build the sbwt
let seqs: Vec<&[u8]> = vec![b"AACTGACTGATCGTCTTGACTCGTTTATCTACGGT", b"ACTGACAGCTCTGCGATGCGA"];
let seq_stream = sbwt::SliceSeqStream::new(seqs.as_slice());
let (sbwt, lcs) = SbwtIndexBuilder::new()
    .k(6).n_threads(4).build_lcs(true).add_rev_comp(true)
    .algorithm(BitPackedKmerSorting::new()
        .mem_gb(2)
        .dedup_batches(false)
        .temp_dir(Path::new("./temp")))
    .run(seq_stream);

// Query a k-mer
let query_kmer = b"GACTCG";
if sbwt.search(query_kmer).is_some() {
    println!("{} is found", &String::from_utf8_lossy(query_kmer));
}

// Query all k-mers of a longer query using k-bounded matching statistics
let lcs = lcs.unwrap(); // Ok because we used build_lcs(true)
let streaming_index = StreamingIndex::new(&sbwt, &lcs);
let long_query = b"TGATACGTCTTAGTGACTCGTTT";
for (i, (len, range)) in streaming_index.matching_statistics(long_query).iter().enumerate() {
    // Kmer ending at long_query[i] exists iff len == k
    println!("Longest match ending at {} has length {} and colex range {:?}", i, len, range);
}

// Write index to disk for later use
sbwt.serialize(&mut BufWriter::new(File::create("index.sbwt").unwrap())).unwrap();
lcs.serialize(&mut BufWriter::new(File::create("index.lcs").unwrap())).unwrap();

Reverse complements and input preprocessing

If your input is very large, you may want to preprocess it to remove duplicate k-mers reduce construction time, memory and disk space. We recommend using a specialized tool such as GGCAT, Cuttlefish or BCALM2 for this purpose.

This crate considers a k-mer distinct from its reverse complement. In the use case where a k-mer is considered equal to its reverse complement, you need to either feed both directions to the index, or feed just one direction but query each k-mer both ways. The former approach can be easily implemented by enabling reverse complements in the builder. For the latter approach, we recommend using one of the unitig construction tools mentioned above to turn the data into canonical unitigs containing each k-mer in only one orientation. After this, it is very important to reorient the unitigs to maintain a consistent orientation for neighboring k-mers since as explained here, each k-mer without a direct predecessor increases the index size. The payoff of this approach is up to two times smaller index size compared to indexing both orientations explicitly, with the drawback that now queries need to be run in both orientations.

De Bruijn graph operations

With the addition of two extra bitvectors, the data structure supports traversal on the node-centric de-Bruijn graph of the input k-mers. The set of nodes is the set of distinct k-mers, and there is an edge from x to y iff x[1..k) = y[0..k-1). The label of the edge is the last character of y. The graph is not aware of reverse complements, so if you want to traverse the bi-directed de Bruijn graph that includes edges where one or both of the endpoints are reverse complemented, you need to take care of that logic yourself. See Dbg for the API.

Construction algorithms

The crate currently provides one construction algorithm: bitpacked k-mer sorting. This extracts all k-mers in the input, packs each k-mer to 2k bits, and sorts them in parallel. This requires O(nk) time and disk space, so it is suitable only for small k. There is still a lot of room for optimization in the implementation. For larger k, a suffix-array-based construction algorithm is planned.

Details on the space usage of the index

The index exploits overlaps between k-mers to encode them in small space. We say that a k-mer x is a source k-mer if it has no incoming edges in the node-centric de Bruijn graph of the input k-mers S, that is, there does not exist a k-mer y ∈ S such that y[1..k) = x[0..k-1). The number of bits in SbwtIndex<SubsetMatrix> is 5(n + n') plus a small constant, where n is the number of distinct k-mers in the dataset, and n' is the number of nodes in the trie of all prefixes of length k-1 of all source k-mers (See here for more details on the inner workings of the SBWT to understand what is going on). When the k-mers are from biological sequences, and unitigs are oriented consistently, the term n' is typically negligible, but if the k-mers are for example a randomly sampled subset, then the benefit of overlaps is lost, and the term n' dominates. In the worst case, n' can be up to n(k-1) + 1.

Limitations

The implementation only supports the DNA alphabet ACGT. For best compression, the input k-mers should originate from a longer underlying sequence so that sbwt is able to exploit the overlaps for better compression. For non-overlapping k-mer sets, a simple hash table is likely a better choice.

Dependencies

~14MB
~240K SLoC