#bioinformatics #dna #minimizers

simd-minimizers

A SIMD-accelerated library to compute random minimizers

9 stable releases

Uses new Rust 2024

new 2.3.0 Jan 20, 2026
2.2.0 Oct 15, 2025
2.0.1 Sep 26, 2025
1.4.0 Sep 3, 2025
1.0.0 Jan 29, 2025

#181 in Biology

Download history 210/week @ 2025-10-01 17/week @ 2025-10-08 182/week @ 2025-10-15 24/week @ 2025-10-22 17/week @ 2025-10-29 1/week @ 2025-11-05 7/week @ 2025-11-12 30/week @ 2025-11-19 9/week @ 2025-12-10 9/week @ 2025-12-24 1/week @ 2025-12-31 21/week @ 2026-01-07 47/week @ 2026-01-14

78 downloads per month
Used in 3 crates

MIT license

125KB
2.5K SLoC

simd-minimizers

crates.io docs

A SIMD-accelerated library to compute random minimizers.

It can compute all the minimizers of a human genome in 4 seconds using a single thread. It also provides a canonical version that ensures that a sequence and its reverse-complement always select the same positions, which takes 6 seconds on a human genome.

This crate builds on packed_seq and seq-hash.

The underlying algorithm is described in the following paper:

Requirements

This library requires AVX2 or NEON instruction sets, which, on x64, requires either target-cpu=native or target-cpu=x86-64-v3. See this README for details and this blog for background. The same restrictions apply when using simd-minimizers in a larger project.

RUSTFLAGS="-C target-cpu=native" cargo run --release

Usage example

Full documentation can be found on docs.rs.

use packed_seq::{PackedSeqVec, SeqVec};

let seq = b"ACGTGCTCAGAGACTCAGAGGA";
let packed_seq = PackedSeqVec::from_ascii(seq);

let k = 5;
let w = 7;
let hasher = <seq_hash::NtHasher>::new(k);

// Simple usage with default hasher, returning only positions.
let minimizer_positions = canonical_minimizer_positions(packed_seq.as_slice(), k, w);
assert_eq!(minimizer_positions, vec![0, 7, 9, 15]);

// Advanced usage with custom hasher, super-kmer positions, and minimizer values as well.
let mut minimizer_positions = Vec::new();
let mut super_kmers = Vec::new();
let minimizer_vals: Vec<u64> = canonical_minimizers(k, w)
    .hasher(&hasher)
    .super_kmers(&mut super_kmers)
    .run(packed_seq.as_slice(), &mut minimizer_positions)
    .values_u64()
    .collect();

// Compute _syncmers_ positions and values instead:
let mut syncmer_positions = Vec::new();
// List of (k+w-1)-mer values.
let syncmer_vals: Vec<u64> = canonical_syncmers(k, w)
    .run(packed_seq.as_slice(), &mut syncmer_positions)
    .values_u64()
    .collect();

Benchmarks

Benchmarks can be found in the bench directory in the GitHub repository.

bench/benches/bench.rs contains benchmarks used in this blogpost.

bench/src/bin/paper.rs contains benchmarks used in the paper.

Note that the benchmarks require some nightly features, you can install the latest nightly version with

rustup install nightly

To replicate results from the paper, go into bench and run

RUSTFLAGS="-C target-cpu=native" cargo +nightly run --release
python eval.py

The human genome we use is from the T2T consortium, and available by following the first link here.

Dependencies

~4MB
~82K SLoC