#bioinformatics #translate #dna #rna #protein

protein-translate

Translate nucleotide sequence to protein

4 releases

✓ Uses Rust 2018 edition

0.2.0 Aug 11, 2019
0.1.2 Aug 9, 2019
0.1.1 Jul 14, 2019
0.1.0 Jul 14, 2019

#60 in Science

24 downloads per month

MIT/Apache

9KB
58 lines

protein-translate

Build Status Cargo Documentation

Translate nucleotide sequence (dna or rna) to protein.

Usage

Add this to your Cargo.toml:

[dependencies]
protein-translate = "0.2.0"

Example

use protein_translate::translate;

fn main() {
    let dna = b"GTGAGTCGTTGAGTCTGATTGCGTATC";
    let protein = translate(dna);
    assert_eq!("VSR*V*LRI", &protein);

    // To shift reading frame
    let protein_frame2 = translate(&dna[1..]);
    assert_eq!("*VVESDCV", &protein_frame2);

}

Benchmarks

The current algorithm is inspired by seqan's implementation which uses array indexing. Here is how it performs vs other methods (tested on 2012 macbook pro).

Method 10 bp* 100 bp 1,000 bp 10,000 bp 100,000 bp 1 million bp
protein_translate 91 ns 0.29 μs 2.28 μs 23 μs 215 μs 2.25 ms
fnv hashmap 111 ns 0.37 μs 3.58 μs 37 μs 366 us 3.86 ms
std hashmap 160 ns 1.03 μs 9.65 μs 100 μs 943 μs 9.40 ms
phf_map 177 ns 1.04 μs 9.47 μs 100 μs 936 μs 9.91
match statement 259 ns 1.77 μs 17.9 μs 163 μs 1941 μs 19.1 ms
protein_translate (unchecked) 90 ns 0.26 μs 2.02 μs 20 μs 197 μs 1.92 ms

*bp = "base pairs"

To benchmark yourself (have to use nightly because of phf_map macro).

cargo +nightly bench

Thoughts

  • FNV seems to be a great option, but I have chosen to use the current implementation due to being slightly faster and not required any dependencies.
  • There was originally a function called translate_unchecked that did not validate each byte for valid ASCII, but since the performance gain was negligible, it was removed.

Todo

  • Add other Codon tables (e.g. Vertebrate Mitochondrial, Yeast Mitochondrial, Mold Mitochondrial, etc.)
  • Add support for ambiguous nucleotides (right now, only supports A, U, T, C, G)

Tests

To test

cargo test

To can also generate new test data (requires python3 and biopython).

# Generate 500 random sequences and their peptides
python3 tests/generate_test_data.py 500

No runtime deps